BBa_K258005 1 BBa_K258005 Oxygen promoter-Vitreoscilla hemoglobin(VHb) promoter in E. coli. 2009-10-03T11:00:00Z 2015-05-08T01:11:42Z gene of Vitreoscilla hemoglobin(VHb). We synthesized synthetically at GENEART. The promoter was maximally induced under microaerobic conditions (dissolved oxygen levels of less than 2% air saturation). Transcriptional activity decreased substantially under anaerobic conditions, suggesting the presence of a regulatory mechanism that is maximally induced under hypoxic but not completely anaerobic conditions in E.coli. Primer extension analysis was used to identify the existence of two overlapping promoterswithin a 150-base-pair region upstream of the structural VHb gene. The oxygen-dependent activity of both promoters was qualitatively similar, suggesting the existence of a common mechanism by which available oxygen concentrations influence expression from the two promoters. Oxygen-dependent control mechanisms revealed in some of the above studies include positive regulation by an activator protein. The bacterium Vitreo-scilla sp. is an obligate aerobe from the Beggiatoa family that synthesizes a hemoglobinlike molecule (VHb) in response to growth in oxygen-poor environments. The expression of the VHb gene (vgb) is regulated by oxygen in both its native host, Vitreoscilla, and in E.coli and is maximally induced under microaerophilic conditions (Dikshit and Webster 1988; Dikshit et al. 1992;Joshi and Dikshit 1994). The purposes were to characterize the response of the promoter to changes in oxygen availability in the environment and to obtain initial insights about the mechanism(s) by the promoter is controlled. false false _358_ 0 4260 9 It's complicated true The palsmid id pMA (GENEART constantpalsmid with Amphicillin resistance and Biobrick restiction sites,EcoR1,Xba1,Spe1 and Pst1) false Cihan Tastan BBa_K258005_sequence 1 aagcttacaggacgctggggttaaagtatttgagttttgatgtggattaagtttagaggcaataaagattataataagtgctgctacaccatactgatgtatggcaaaccataataatgaacttaaggaagaccctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z