BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331786 1 stem_loop range331786 1 22 37 annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 BBa_K259012 1 BBa_K259012 AraC-RBS-OsmE 2009-10-14T11:00:00Z 2015-05-08T01:11:42Z AraC - occurs naturally in E.coli genome. This part was created by assembling parts R0081 and R0080 together. RBS - Designed from the Anderson family. A strong RBS for high translation rates. OsmE - Obtained via PCR gene cloning from the E.coli MG1655 genome. This part will express the protein OsmE that is found on the Outer Membrane of E.coli cells. This protein is osmotically inducible but of unknown function. The part currently carries an illegal EcoRI site that can be mutated out (contact us for information). It is useful for protein fusions when the user wants to deliver proteins to the outer membrane. For protein fusions the part can be used with Bioscaffolds designed by the BCCS-Bristol iGEM'09 team, that facilitate protein fusion (<partinfo>Bba_K259002</partinfo><partinfo>Bba_K259004</partinfo>). At the time of writing only part Bba_K259002 is supported. false false _357_ 0 5318 9 It's complicated false Part was designed using 2-way ligation to avoid EcoRI site. false Petros Mina component2041255 1 BBa_K259011 component2041254 1 BBa_J61100 component2041253 1 BBa_R0080 component2041246 1 BBa_R0081 annotation2041254 1 BBa_J61100 range2041254 1 349 360 annotation2041253 1 BBa_R0080 range2041253 1 192 340 annotation2041255 1 BBa_K259011 range2041255 1 367 708 annotation2041246 1 BBa_R0081 range2041246 1 1 183 BBa_K259011 1 BBa_K259011 OsmE-Outer Membrane Protein in E.coli 2009-10-14T11:00:00Z 2015-05-08T01:11:42Z This part occurs naturally in the E.coli genome at 39.27 minutes in the counterclockwise direction. [http://ecogene.org/geneinfo.php?eg_id=EG10044 | EG10044 EcoGENE accession number] This is an Outer Membrane monomeric protein in E.coli. It is an osmotically inducible lipoprotein, not toxic but it's usage is unknown. false false _357_ 0 5318 9 It's complicated false This part carries an unmutated EcoRI site. false Petros Mina BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301457 1 araO1 range301457 1 6 44 annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation301458 1 c-amp1 range301458 1 43 72 annotation308602 1 -10 range308602 1 136 141 annotation301456 1 c-amp2 range301456 1 4 29 annotation308601 1 -35 range308601 1 113 118 BBa_J61100_sequence 1 aaagaggggaca BBa_K259011_sequence 1 atgaacaagaatatggcaggaattctgagtgcagcggcggtattaaccatgctggcgggttgtacggcttatgatcgtaccaaagaccagtttgtacagcctgtggtgaaagacgtcaaaaaaggcatgagccgggcgcaggttgcacaaattgcgggtaaaccttcgtctgaagtgagcatgatccatgctcgcggtacttgccagacctacatcctgggtcaacgtgatggtaaagcagaaacctactttgtcgcgttagatgataccggacatgtcatcaactccggttatcagacctgtgctgaatacgacactgatccacaggctgcgaagtaataa BBa_K259012_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggacatactagatgaacaagaatatggcaggaattctgagtgcagcggcggtattaaccatgctggcgggttgtacggcttatgatcgtaccaaagaccagtttgtacagcctgtggtgaaagacgtcaaaaaaggcatgagccgggcgcaggttgcacaaattgcgggtaaaccttcgtctgaagtgagcatgatccatgctcgcggtacttgccagacctacatcctgggtcaacgtgatggtaaagcagaaacctactttgtcgcgttagatgataccggacatgtcatcaactccggttatcagacctgtgctgaatacgacactgatccacaggctgcgaagtaataa BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z