BBa_K265011 1 BBa_K265011 OmpA with proteolytic cleavage tag 2009-10-14T11:00:00Z 2015-05-08T01:11:43Z The OmpA was part BBa_K103006 with a couple modified restriction sites. The signal sequence was synthesized by Mr. Gene. This part is a fusion of a modified OmpA with a signal sequence to allow cleavage when a protein is fused. OmpA was modified by replacing the normal restriction sites with Tom Knight's fusion format. An OmpA/protein fusion normally allows display of proteins on the cell surface. The addition of this signal sequence allows secretion by allowing cleavage after display. false false _362_ 0 4713 9 It's complicated true None false Richard Hauser annotation2047260 1 BBa_K103006 range2047260 1 1 464 annotation2047263 1 linker range2047263 1 439 464 annotation2047261 1 ATG range2047261 1 4 6 annotation2047262 1 OmpA range2047262 1 4 438 annotation2047264 1 BBa_K265002 range2047264 1 471 584 annotation2047286 1 Proteolytic Cleavage Sequence range2047286 1 471 584 annotation2047259 1 NdeI range2047259 1 1 7 BBa_K265011_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctcgctagtatgctggccaagcagatcaagaaggctaatagccgctctacactgctacgcaaatcactgttattcgcagcccctatcatcttagcagtttcatcgtcctccgtatatgcgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z