BBa_K273020 1 E1A1 E1A1 2009-10-15T11:00:00Z 2015-05-08T01:11:44Z Created with... Against target sequence ... E1A1 regulatory RNA against the Pyruvate dehydrogenase subunit one (E1), the alfa subunit of said protein (A, and number one such RNA created. Will be expressed with non free biobrick interfaces which hopefully not affect performance. false false _373_ 0 4680 9 Not in stock false - false Anders Kristoffersson BBa_K273020_sequence 1 aaggggaaggggttttatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z