BBa_K273022 1 E1A3 E1A3 2009-10-16T11:00:00Z 2015-05-08T01:11:44Z Desigend by the Uppsala iGEM Team 2009 __NOTOC__ <partinfo>BBa_K273022 short</partinfo> E1A2 antisense RNA against the formation of pyruvate dehydrogenase complex (PDC). Target is pyruvate dehydrogenase E1 (EC 1.2.4.1), in partuclar the alfa subunit (A). Antisense RNA approach #3.<br> Will be transcribed together with the BioBrick interface and may affect the performance of the antisense RNA molecule.<br> EXYZ<br> EX: E1 enzyme subunit of the PDC complex<br> Y: a=Alpha subunit of the particular enzyme subunit<br> b=beta subunit of the particular enzyme subunit<br> Z: # of antisense RNA approach<br> ==Usage and Biology== Antisense RNA function supposed to fuction through either Shine Dalgarno blocking and/or RNA elongation blocking. false false _373_ 0 5250 9 Not in stock false BioBrick interace will be transcribed as well and may influence the performance of the antisense molecule. false Karl Brune BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K273034 1 E1A3 - Ter E1A3 - Ter 2009-10-17T11:00:00Z 2015-05-08T01:11:44Z - - false false _373_ 0 5250 9 It's complicated false - false Karl Brune component2049767 1 BBa_K273022 component2049768 1 BBa_B0010 component2049770 1 BBa_B0012 annotation2049768 1 BBa_B0010 range2049768 1 59 138 annotation2049770 1 BBa_B0012 range2049770 1 147 187 annotation2049767 1 BBa_K273022 range2049767 1 1 50 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K273034_sequence 1 tctgaaaccatagtacaatttgcagtagataaaggggaaggggttttatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K273022_sequence 1 tctgaaaccatagtacaatttgcagtagataaaggggaaggggttttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z