BBa_K277051 1 BBa_K277051 3L.3_23.B2.11 2009-10-20T11:00:00Z 2015-05-08T01:11:46Z Synthetic Yeast 3L.3_23.B2.11 is 699 bases long and is cloned into the pGem-T vector. 3L.3_23.B2.11 was designed as a piece of synthetic chromosome 3 with the goal of minimizing and stabilizing that chromosome and to that end has had any tRNAs, introns, repeat regions, and transposons that were present in the wildtype chromosome removed. In addition a very few gene sequences were slightly recoded to add or remove restriction enzyme recognition sites to facilitate assembly; most gene sequences were slightly recoded to introduce unique primers for diagnostic PCR amplification, and some gene sequences were slightly recoded to address the distribution of stop codon usage. 3L.3_23.B2.11 is a constituent of 3L.3_23.B2 (along with 3L.3_23.B2.01, 3L.3_23.B2.02, 3L.3_23.B2.03, 3L.3_23.B2.04, 3L.3_23.B2.05, 3L.3_23.B2.06, 3L.3_23.B2.07, 3L.3_23.B2.08, 3L.3_23.B2.09, 3L.3_23.B2.10, and 3L.3_23.B2.12.) This part contains at least part of the following features (positions offset from first base of sequence): kind and name offset notes gene YCL045C (-2135..147) Protein of unknown function%3B green fluorescent protein (GFP)-fusion protein localizes to the ER%3B interacts with Gal80p%3B YCL045C is not an essential gene gene YCL044C (387..+1640) Subunit%2C with Yme1p%2C of the mitochondrial inner membrane i-AAA protease complex%2C which is responsible for degradation of unfolded or misfolded mitochondrial gene products%3B required for growth of cells lacking the mitochondrial genome mutation_affecting_coding_sequence YCL044C_re_remove_BlpI (498..506) removal of BlpI gene YCL046W (-118..205) Hypothetical protein loxP_site loxPsym_YCL044C (350..383) Sequence (the first 699 bases correspond to coordinates 37064..37762 in synthetic chromosome yeast_chr3_3_23) false false _385_ 0 2669 9 It's complicated false Constructed using overlap extension PCR protocol described in RFC38 false James DiCarlo BBa_K277051_sequence 1 atcagggatgactttctcccaaggacctaagttagccagttgccaatcagtgataaatgcatcatctgaaaaaacggcttggacacaactcgtgtttaggaagagtaaaatgaagacgtacaccaagtctgtacacgttatcttcattgctatgggggaaggggaggatgaaagtgttgatatgaatgtaggtattagttattaatggagtgtatatatatatatgttattatatatttgcatatataatatgaaatcccagccatattttctctggtagccgtctgaaaaatcacggtgtacgaagaaggatttaatatacgcacggtacaactaagcaatccgcaaaataacttcgtataatgtacattatacgaagttatgacttaatgtgtcttttcattagtgagagccttgggggtaggccctggtaacggctggtccgtgctagtgggtgtcttggtatgggagggcatggtagttggtatgaatttgatgcttagactagtttctaaggccaaagtcatccatggatcataaagcgatcttattgtatcgagatcaatatcttgcgggcctttcgtgtcatggggcaaaatgacacctcgggagagtgtggtgctggatctcttctttactggtgcggaaatggaatctcccgaagatgctaagaaatgcagtcttttttccacattttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z