BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2213991 1 Help:Barcodes range2213991 1 751 775 annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 BBa_K283033 1 BBa_K283033 constitutive promoter-rbs-CI (lambda LVA) 2009-10-15T11:00:00Z 2015-05-08T01:11:47Z The rbs, double terminator comes from the registry This part generates chez protein under a hypoxia inducible promoter panas. The cheZ protein is responsible for the dephosphorylation of cheY protein in bacteria flagella movement and is tagged by a 6-Histidine tail. false false _383_ 0 5494 9 It's complicated true BBa_K283033 false Shi Lei, Nelson Chu, W Ling component2246767 1 BBa_J23100 component2246773 1 BBa_C0051 component2246769 1 BBa_B0034 annotation2246769 1 BBa_B0034 range2246769 1 44 55 annotation2246767 1 BBa_J23100 range2246767 1 1 35 annotation2246773 1 BBa_C0051 range2246773 1 62 836 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_K283033_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z