BBa_K284032 1 BBa_K284032 finO conjugal transfer fertility inhibition protein FinO from Plasmid R100 2009-10-15T11:00:00Z 2015-05-08T01:11:48Z E. coli R100 Plasmid (conjugative) the basic protein FinO is part of the the two component FinOP system which is responsible for repressing bacterial conjugation; the FinOP system represses the transfer (tra) operon of the F-plasmid which encodes the proteins responsible for conjugative transfer of this plasmid from host to recipient Escherichia coli cells; antisense RNA, FinP is thought to interact with traJ mRNA to occlude its ribosome binding site, blocking traJ translation and thereby inhibiting transcription of the tra operon; FinO protects FinP against degradation by binding to FinP and sterically blocking the cellular endonuclease RNase E; FinO also also binds to the complementary stem-loop structures in traJ mRNA and promotes duplex formation between FinP and traJ RNA in vitro; this domain contains two independent RNA binding regions. false false _386_ 0 4974 9 Not in stock false FinO was amplified from E. coli R100 Plasmid (conjugative) false Marcelo Colika Bassalo, Gabriel Francisco Zaniboni, Victor Augusti Negri and Bruno Vaz de oliveira annotation2046232 1 cds range2046232 1 1 561 annotation2046231 1 stop range2046231 1 559 561 annotation2046230 1 start range2046230 1 1 3 BBa_K284032_sequence 1 atgacagagcagaaacgaccggtactgacactgaaacggaaaacggaaggggaaacaccgacccggagccggaaaaccatcatcaatgtcaccacgccaccaaaatggaaggtgaaaaagcagaaactggcggagaaggctgcccgggaagcagagctgacagcaaaaaaagcgcaggccagacaggcgctgtccatttatctgaacctgccctcgctggatgaggccgtgaacaccctgaaaccctggtggccgggattatttgacggtgacacaccccgacttctggcctgcggtatccgggacgtgttactggaagacgtggcgcagcggaatatcccgctctcgcataaaaaactgcgcagggcgctgaaggccatcacccgttcagaaagctatctgtgtgccatgaaagccggtgcctgccggtatgacacggaagggtatgtgacggagcatatttctcaggaggaagaagtgtatgcggcagagcgtctggataaaatccgccgccagaaccggataaaggcagaacttcaggccgtgcttgatgaacaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z