BBa_K294208 1 BBa_K294208 luxC gene, acyl-CoA reductase LuxC from Vibrio fischeri ES114 2010-05-21T11:00:00Z 2015-05-08T01:11:49Z I obtained this sequence from Genbank accession no Y00509. We want to build a bacterial lava lamp. This is the first gene in the luxCDABE operon. It helps to biosynthesize the luciferase substrate for endogenous production. We chose to use the Vibrio fischeri gene because we love Vibrio fischeri. false false _397_ 0 126 162 Not in stock false Added a 7xhis tag to the N terminus. I changed the stop codon to TAATAA. false Reshma Shetty annotation2069252 1 LuxC protein range2069252 1 1 243 annotation2069241 1 ATG start codon range2069241 1 1 3 BBa_K294208_sequence 1 atgaataaatgtattccaatgataattaatggaatgattcaagattttgataattatgcatataaagaagttaaactaaataatgataatagagtaaaattatctgtcattactgaaagttcagtttcaaaaacattaaatatcaaagatagaattaatctaaatttaaatcagattgtgaattttttatataccgttggtcaacgatggaaaagtgaagaatataatcggcgacgaacctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z