BBa_K301003 1 BBa_K301003 T7 promoter 2010-10-24T11:00:00Z 2015-05-08T01:11:52Z T7 promoter sequence Released HQ 2013 T7 promoter is used as part of the "positive loop" for the self-inducing system in HYPOXON project. The constitutive promoter regulate the expression of the promoter activator, T7 RNA Polymerase, in order to produce the downstream product continuously. false false _484_ 0 5136 9 In stock false Part was obtained by oligonucleotide synthesis. false Xiang Chen annotation2099978 1 promoter range2099978 1 1 23 BBa_K301003_sequence 1 taatacgactcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z