BBa_K311000 1 BBa_K311000 Constitutive tet promoter with mRFP 2010-10-14T11:00:00Z 2015-05-08T01:11:54Z part BBa_J23105 in plasmid Bba_J61002 It is a tet constitutive promoter isolated from a small combinatorial library. The promoter is one of the weakest promoters in the library. The mRFP is placed downstream to the promoter. The activity of the promoter was checked in TOP10 cells, which are negative for tet repressor, and also in DH5 alpha pro cells which have tet repressor gene integrated into the genome. The red fluorescence was measured by FACs with different inducer concentrations in both the cell types. It was observed that the under all the inducer concentrations the promoter activity remains the same. false false _430_ 0 7095 9 In stock false Plasmid Bba_J61002 was digested with EcoRI and PstI enzymes and ligated into EcoR I and Pst I cut plasmid pSB1C3. false Matthew Adams, Poonam Srivastava, Ian Windsor annotation2086596 1 BBa_J23105 range2086596 1 1 35 BBa_K311000_sequence 1 tttacggctagctcagtcctaggtactatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z