BBa_K311001 1 BBa_K311001 Strong and constitutive tet promoter with downstream mRFP 2010-10-14T11:00:00Z 2015-05-08T01:11:54Z It came from the part J23118 and plasmid J61002. Released HQ 2013 It is a constitutive tet promoter isolated from a small combinatorial library. The promoter is one of the strongest promoters in the library. The mRFP is placed downstream to the promoter. The activity of the promoter was checked in TOP10 cells, which are negative for the tet repressor, and also in DH5 alpha pro cells which have tet repressor gene integrated into the genome. The red fluorescence was measured by FACs with different inducer concentrations in both the cell types. It was observed that under all the inducer concentrations the promoter activity remains the same. It was reported to have 2 fold higher activity than the J23105. false false _430_ 0 7095 9 In stock false the promoter with mRFP was obtained by digesting the plasmid J61002 with EcoRI and Pst I and ligating it to Eco RI and Pst I cut pSB1C3. false Matthew Adams, Poonam Srivastava, Ian Windsor annotation2086597 1 BBa_J23118 range2086597 1 1 35 BBa_K311001_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z