BBa_K313024 1 BBa_K313024 as RNA target1 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. This is a part coding asRNA of BBa_K313023. false false _433_ 0 5929 9 Not in stock false nothing special false Ryo Kariyazono, Ryosuke Kamei, Mingshuo Zeng BBa_K313024_sequence 1 caggctgattacgtcacgcgctggtttctcctctttaatcaggctgattacgtcacgcgctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z