BBa_J31000 1 Hin DNA-invertase Hin from Salmonella typhimurium 2006-06-04T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium Generates the Salmonella typhimurium Hin protein. This protein is used to invert DNA that is flanked by Hix siteds. false false _61_ 0 918 61 It's complicated false none really false Erin Zwack, Sabriya Rosemond annotation1910569 1 Rev primer J31001 range1910569 1 551 570 annotation1880460 1 Mutation to delete the SpeI site range1880460 1 72 72 annotation1880459 1 Former SpeI site range1880459 1 70 75 annotation1884987 1 Hin sequence range1884987 1 1 573 annotation1910568 1 Fwd primer J31001 range1910568 1 1 3 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K313030 1 BBa_K313030 signal transmission assay device 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z This part is composed of BBa_I712074, BBa_K313010, BBa_B0030, BBa_J31000 , BBa_B0014 This is a device that aims to test the MS2 phage loading sequence BBa_K313010. false false _433_ 0 5929 9 It's complicated false nothing special false Tomoka Ao, Ryosuke Kamei, Ryo Kariyazono, Kosuke Uekusa component2093950 1 BBa_I712074 component2093953 1 BBa_B0030 component2093951 1 BBa_K313010 component2093960 1 BBa_J31000 component2093967 1 BBa_B0014 annotation2093953 1 BBa_B0030 range2093953 1 82 96 annotation2093950 1 BBa_I712074 range2093950 1 1 46 annotation2093951 1 BBa_K313010 range2093951 1 55 73 annotation2093960 1 BBa_J31000 range2093960 1 103 675 annotation2093967 1 BBa_B0014 range2093967 1 684 778 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K313010 1 BBa_K313010 loading sequence of RNA phage MS2 2010-10-21T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. lorem ipsum false false _433_ 0 5929 9 It's complicated false nothing special false Ryosuke Kamei, Ryo Kariyazono, Takashi Matsumoto, Takashi Hiroi, Mei Kobayashi, Yuka Yashiro, Tomoka Ao BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0030_sequence 1 attaaagaggagaaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_J31000_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K313010_sequence 1 acatgaggattacccatgt BBa_K313030_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagacatgaggattacccatgttactagagattaaagaggagaaatactagatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z