BBa_K316018 1 BBa_K316018 ComE responsive promoter 2010-10-24T11:00:00Z 2015-05-08T01:11:56Z Streptococcus pneumoniae ComE binds to a specific sequence leading to activation of trancription. false false _440_ 0 7480 9 It's complicated false codon optimised for B. subtilis false IC 2010 Team annotation2098221 1 Start site of transcription range2098221 1 135 135 annotation2098402 1 ComE Binding site 2 range2098402 1 82 90 annotation2098401 1 ComE Binding site 1 range2098401 1 60 69 BBa_K316018_sequence 1 tgctgggatcaatataatagcaaagctgggaattttcccggcttttttcttaaaaaagtacactttgggagaaaaaaatgacagttgagagaattttatctaaaacgaaattccattttgtataatggtttttgtaagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z