BBa_K316024 1 BBa_K316024 Chloraphenicol resistance gene with dif and 5amyE 2010-10-22T11:00:00Z 2015-05-08T01:11:56Z Biobrick parts <bbpart>BBa_K143070</bbpart> (which contains <bbpart>BBa_K143001</bbpart>, <bbpart>BBa_K143012</bbpart>, <bbpart>BBa_K143021</bbpart>) and <bbpart>BBa_K143064</bbpart> (which contains <bbpart>BBa_K143031</bbpart>, <bbpart>BBa_B0015</bbpart>) This part is identical to <bbpart>BBa_K143023</bbpart> except for the dif site<bbpart>BBa_K3160</bbpart> integrated behind the 5' amye <bbpart>BBa_K143001</bbpart> integration sequence. Chloramphenicol acetyltransferase (CAT) <bbpart>BBa_J31005</bbpart> confers resistance to chloramphenicol, a common lab selection antibiotic. The 5' amyE <bbpart>BBa_K143001</bbpart> integration sequence allows integration into B. subtilis genome, which disrupts ability to breakdown starch. In order for integration to occur, 3' amyE integration sequence <bbpart>BBa_K143002</bbpart> is also required. This part can be used as the 5' start of an amyE integration vector, the genes of interest can then be attached to the 3' end, followed by the 3' amye integratio sequwnce <bbpart>BBa_K143002</bbpart>. false false _440_ 0 7480 9 It's complicated false Reverse PCR' was used to amplify the whole vector, while adding the dif sites by primer extension. Pfu polymerase was used to ensure error-free replication. false IC 2010 Team component2098987 1 BBa_K143064 component2098978 1 BBa_K143021 component2098976 1 BBa_K316002 component2098975 1 BBa_K143001 annotation2098978 1 BBa_K143021 range2098978 1 567 578 annotation2098975 1 BBa_K143001 range2098975 1 1 522 annotation2098987 1 BBa_K143064 range2098987 1 585 1381 annotation2098976 1 BBa_K316002 range2098976 1 531 558 BBa_K143064 1 CmR-T Chloramphenicol resistance protein - Terminator 2008-10-08T11:00:00Z 2015-05-08T01:10:24Z The Chloraphemicol acetyltransferase and double terminator were taken both taken from the registry. Chloraphemicol acetyltransferase protein(<bbpart>BBa_J31005</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>). Chloraphemicol acetyltransferase confers resistance to Chloraphemicol. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the CAT to be incorporated into a closed transcriptional unit. false true _199_ 0 3475 9 It's complicated true Chloraphemicol acetyltransferase is an exisiting registry protein. The double terminator is the most commonly used registry termiantor. true Chris Hirst component1980004 1 BBa_B0010 component1980003 1 BBa_J31005 component1980006 1 BBa_B0012 annotation1980006 1 BBa_B0012 range1980006 1 757 797 annotation1980003 1 BBa_J31005 range1980003 1 1 660 annotation1980004 1 BBa_B0010 range1980004 1 669 748 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K143001 1 amyE 5 IS 5??? Integration Sequence for the amyE locus of B. subtilis 2008-08-26T11:00:00Z 2015-05-08T01:10:23Z The 5??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on ''B.subtilis'', in particular in the studies of transcriptional control<cite>#1 #2 #3</cite> <biblio> #1 pmid=14597697 #2 pmid=15937167 #3 pmid=12169614 </biblio> Released HQ 2013 The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into ''B.subtilis'' by Shimotsu and Henner<cite>#1</cite> and is still commonly used in vectors such as pDR111<cite>#2</cite>, pDL<cite>#3</cite> and their derivatives. Integration at the AmyE locus removes the ability of ''B.subtilis'' to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn<cite>#4</cite>. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the ''B.sutbilis'' chromosome. <biblio> #1 pmid=3019840 #2 pmid=14597697 #3 ''Bacillus'' Genetic Stock Center [www.bgsc.org] #4 Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. </biblio> false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the ''B.subtilis'' chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 5' end of the gene is the 5' sequence required for integration. true Chris Hirst annotation1974145 1 5' AmyE homologous sequence range1974145 1 1 522 BBa_J31005 1 CmR chloramphenicol acetyltransferase (forwards, CmF) [cf. BBa_J31004] 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z pSB1AC3 When a promoter and an RBS are in front of the gene, the cell will express Chloramphenicol resistance. Because it contains full biobrick ends, this part can be used to easily add chloramphenicol resistance to any part without changing plasmid vectors. false true _61_ 0 918 61 In stock true This part is cloned into pSB1A2. true Erin Zwack, Sabriya Rosemond annotation1884999 1 CmR gene range1884999 1 1 660 BBa_K316002 1 Bs dif dif excision site from B. subtilis 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z The dif sites were made by annealing synthestised oligoes. Dif sites are naturally found in B.subtilis and are used by this organism during genome replication. false false _440_ 0 7480 9 Not in stock false The dif site was made by oligos designed to make overhangs for EcoRI and SpeI ( and ) or XbaI and PstI ( and ) to be used in standard Biobrick or 3A cloning. false IC 2010 Team BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K316024_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcgatactagagatctcctagaatatatattatgtaaacttactagagaaaggtggtgaatactagatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143064_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K316002_sequence 1 atctcctagaatatatattatgtaaact BBa_K143021_sequence 1 aaaggtggtgaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31005_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaa BBa_K143001_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z