BBa_I718017 1 lox71 lox71 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed Released HQ 2013 Lox71 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularly in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox71 and a lox66 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox71 & lox66 sites is potentially interesting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modifaication was made on lox71 sequence true Eimad Shotar BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_I718016 1 lox66 lox66 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed lox66 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularily in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox66 and a lox71 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox66 & lox71 sites is potentially interresting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modidification was made on the lox66 sequence true Eimad Shotar BBa_K318029 1 BBa_K318029 lox66 + pCons + SapI + rlox71 2010-07-12T11:00:00Z 2015-05-08T01:11:58Z From Synthesis This composite part is a prefix testing cassette for Cre recombination by flipping. false false _438_ 0 6061 9 Not in stock true The SapI restriction site can be used to insert DNA with ATC sticky ends in order to modify the length of recombination. false Justin Vrana, Nate Pantalone component2073482 1 BBa_I718017 component2073481 1 BBa_J23100 component2073480 1 BBa_I718016 annotation2073482 1 BBa_I718017 range2073482 1 86 119 annotation2073481 1 BBa_J23100 range2073481 1 43 77 annotation2073480 1 BBa_I718016 range2073480 1 1 34 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_I718017_sequence 1 taccgttcgtatacgatacattatacgaagttat BBa_K318029_sequence 1 ataacttggtatagcatacattatacgaacggtatactagagttgacggctagctcagtcctaggtacagtgctagctactagagtaccgttcgtatacgatacattatacgaagttat BBa_I718016_sequence 1 ataacttggtatagcatacattatacgaacggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z