BBa_K323217 1 BBa_K323217 T7 promoter with start codon and hexahistidine tag 2010-10-26T11:00:00Z 2015-05-08T01:12:02Z Sequence was amplified from pET vector. T7 promoter enables high production of desired protein in production strain E. coli (DE3)pLysS false false _443_ 0 6971 9 Not in stock false - false Tina Lebar BBa_K323217_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaagaaggaggtaaataatgtatcatcaccatcaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z