BBa_K331008 1 BBa_K331008 Outer Membrane Protein OmpA 2010-06-27T11:00:00Z 2015-05-08T01:12:04Z As in part BBa_K331006 Catechol 1,2-dioxygenase from part (BBa_K331006) with an arginine tag which will allow for targeting into the lumazine Synthase microcompatment (BBa_K331000) false false _463_ 0 4444 9 In stock false Removed start codon false Lisza Bruder BBa_K331008_sequence 1 atgaaaaaaaccgcgattgcgctggcggtggcgctggcgggctttgcgaccgtggcgcaggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z