BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K360023 1 BBa_K360023 trpL promoter 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z LovTAP was assembled by Strickland et al. Reference Strickland, D., Moffat, K., & Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. Released HQ 2013 LovTAP This photoreceptor was assembled by Strickland et al., and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2) that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is called LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed A???&#945; and J&#945;, respectively. In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal J&#945; ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. Under the presence of light, absorption of a photon leads to the formation of a covalent adduct between the flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in the AsLOV2 domain, which results in conformational rearrangements in LovTAP. This change impacts the affinity of the shared helix for the two domains: disrupting the contacts between the shared helix and the LOV domain and enabling the association of the shared helix with the TrpR domain, which establishes DNA-binding affinity and LovTAP can then bind DNA as an homodimer, repressing the transcription of the genes downstream of its binding sites. In the dark, when the shared helix contacts the LOV domain, the TrpR domain's DNA-binding affinity decreases and LovTAP is in an inactive conformation. false true _485_ 0 6618 9 In stock false We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191006[1] that is already at the registry, has the following differences: 1. The 2 '''PstI restriction sites''' were '''removed''' from the coding region of LovTap. 2. We included a punctual mutation to change the '''ILE427 by a PHE427''', as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 5. The stop codon tga was changed for two taa. 1. Registry entry: Part:BBa_K191003 2. Wiki Team: EPF-Laussane. Simulations and results of predicted lovTAP mutations. 3. Wiki Team: EPF-Laussane. LovTAP characterization results. 4. Registry entry: Part:BBa_B0030 5. Registry entry: Part:BBa_B0032 6. Registry entry: Part:BBa_R0010 false Claudia Ivonne Hernandez Armenta, Jorge Zepeda annotation2091494 1 trpR binding site -11.5 range2091494 1 21 40 annotation2091495 1 trpR binding site -19.5 range2091495 1 13 30 annotation2091493 1 trpR binding site -3.5 range2091493 1 29 45 annotation2091496 1 -35 range2091496 1 3 11 annotation2091497 1 -10 range2091497 1 28 35 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0240 1 GFP report GFP generator 2004-10-17T11:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 B0032.E0040.B0015 false true _11_1_ 0 61 7 In stock false true Jennifer Braff component1249216 1 BBa_E0040 component1249221 1 BBa_B0010 component1249213 1 BBa_B0032 component1249231 1 BBa_B0012 annotation1249231 1 BBa_B0012 range1249231 1 836 876 annotation1249216 1 BBa_E0040 range1249216 1 20 739 annotation1249221 1 BBa_B0010 range1249221 1 748 827 annotation1249213 1 BBa_B0032 range1249213 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K360124 1 BBa_K360124 trpL promoter + GFP 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z The seven bases spacer is the one from Escherichia coli's LacZ gene. Strong RBS (BBa_B0034) with a spacer of seven bases between the RBS and the start codon which makes more efficient the transcription. false false _485_ 0 6838 9 Not in stock false We haven't characterized t yet, so compared with other spacers we don't know the exact yield. false Claudia Ivonne Hernandez Armenta, Jorge Arturo Zepeda Mart??nez component2091687 1 BBa_K360023 component2091698 1 BBa_E0240 annotation2091698 1 BBa_E0240 range2091698 1 58 933 annotation2091687 1 BBa_K360023 range2091687 1 1 49 BBa_K360124_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacgtactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K360023_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacg BBa_B0032_sequence 1 tcacacaggaaag BBa_E0240_sequence 1 tcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z