BBa_K360141 1 BBa_K360141 Min. Blue Promoter + RBS + GFP BBa_E0040 2010-10-21T11:00:00Z 2015-05-08T01:12:12Z The Minimum Blue Light Receptor Promoter was synthesized in a primer to join it with any plasmid in BioBrick format. The Strong RBS and spacer where taken from lacZ gene of Escherichia coli. The GFP BBa_E0040 was taken from the already registered part. This is a composite part that consists in our Minimum Blue Light Receptor Promoter (BBa_K360041) with our Strong RBS with spacer (BBa_K360031) and GFP BBa_E0040. false false _485_ 0 7013 9 It's complicated true See design considerations for Minimum Blue Light Receptor Promoter BBa_K360041. false Jorge Eduardo Buend??a Buend??a component2092312 1 BBa_E0040 component2092307 1 BBa_K360041 component2092310 1 BBa_K360031 annotation2092312 1 BBa_E0040 range2092312 1 76 795 annotation2092310 1 BBa_K360031 range2092310 1 59 69 annotation2092307 1 BBa_K360041 range2092307 1 1 50 BBa_K360031 1 BBa_K360031 Strong RBS with spacer. 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z From lacZ gene of Escherichia coli. Strong RBS with a seven bases spacer before start codon. false false _485_ 0 6838 9 Not in stock false It works very well, although the spacer is not the strongest. false Jorge Arturo Zepeda Mart??nez annotation2091558 1 Spacer range2091558 1 5 11 annotation2091557 1 RBS range2091557 1 1 4 BBa_K360041 1 BBa_K360041 Minimum Blue Light Receptor Promoter 2010-09-11T11:00:00Z 2015-05-08T01:12:12Z Synthetized as a primer to insert this minimum blue promoter into a plasmid This is a short version of the promoter (BBa_K238013) activated by the blue light receptor system YcgF/YcgE, the original promoter was described and characterized by the K.U. Leuven 2009 team. This short promoter includes nucleotides from 26-75 of the original sequence reported by the K.U. Leuven 2009 team. false false _485_ 0 7013 9 It's complicated true When designing this short version of the blue promoter we considered to include the following elements: -35 box, spacer, -10 box, TSS and inverted repeat 1 and 2 false Jorge Eduardo Buend??a Buend??a annotation2079889 1 inverted repeat part 2 range2079889 1 42 48 annotation2079890 1 transcription start site range2079890 1 38 40 annotation2079886 1 spacer range2079886 1 9 26 annotation2079885 1 -35 box range2079885 1 3 8 annotation2079887 1 -10 box range2079887 1 27 33 annotation2079888 1 inverted repeat part 1 range2079888 1 28 34 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K360041_sequence 1 tgtacacatatttcgtacaagtttgctattgttacttcacttaacattga BBa_K360031_sequence 1 aggaaacagct BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K360141_sequence 1 tgtacacatatttcgtacaagtttgctattgttacttcacttaacattgatactagagaggaaacagcttactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z