BBa_K371017 1 BBa_K371017 pduV1-98 2010-10-08T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkman This part encodes the 1-98 amino acid of the N terminus pdu V proterin. The N terminus of Pdu V is thought to target to the outside of bacterial microcompartment. false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2247440 1 pduV1-98 range2247440 1 1 188 BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105194 1 SacI range2105194 1 1 6 annotation2105195 1 EarI range2105195 1 4 9 annotation2105192 1 SapI range2105192 1 3 9 annotation2105193 1 meta-prefix range2105193 1 1 10 BBa_K371029 1 BBa_K371029 MPF(meta-prefix)+pduV98 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z BBa_K371049 BBa_K371014 from partsregistry This is an intermediate part. To see the complete part, go to BBa_K371030 false false _498_ 0 3984 9 Not in stock false RFC 53 false Yang Zhang component2372981 1 BBa_K371049 component2372983 1 BBa_K371017 annotation2372983 1 BBa_K371017 range2372983 1 11 198 annotation2372981 1 BBa_K371049 range2372981 1 1 10 BBa_K371029_sequence 1 gagctcttcaatgaaacgcataatgctaattggccccagccagtgcggtaaaacgtcgctcacacagtgcatgcgcggagaggtgctccactatcagaagacccaggccatagtctggtcacctacgacaatagacacaccgggtgaatatcttgagaaccgctgcctgtacagtgcgctgctggccagcgcctgtga BBa_K371017_sequence 1 atgaaacgcataatgctaattggccccagccagtgcggtaaaacgtcgctcacacagtgcatgcgcggagaggtgctccactatcagaagacccaggccatagtctggtcacctacgacaatagacacaccgggtgaatatcttgagaaccgctgcctgtacagtgcgctgctggccagcgcctgtga BBa_K371049_sequence 1 gagctcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z