BBa_K374006 1 BBa_K374006 Lambda N anti-terminator. 2010-10-16T11:00:00Z 2015-05-08T01:12:16Z N gene from the lambda phage from E.coli. In lambda bacteriophage, gene expression is regulated by the suppression of transcription termination (antitermination) which is mediated by the lambda N protein that interacts with the nut site which is a cis-acting element [1]. This part contains the lambda N gene which will suppress transcription termination downstream of part BBa_K374005. [1] Nudler, E. and Gottesman, M.E (2002). Transcription termination and anti-termination in E. coli. Genes to cells 7: 755-768. false false _520_ 0 6199 9 It's complicated true N/A. false Patrick Fortuna, Thomas Trolle, Anastasiya S. Haugaard, Martin Malthe Borch, Juliet Frederiksen BBa_K374006_sequence 1 atgtgccaatcgcggggggttttcgttcaggactacaactgccacacaccaccaaagctaactgacaggagaatccagatggatgcacaaacacgccgccgcgaacgtcgcgcagagaaacaggctcaatggaaagcagcaaatcccctgttggttggggtaagcgcaaaaccagttaaccgccctattctctcgctgaatcgcaaaccgaaatcacgagtagaaagcgcactaaatccgatagaccttacagtgctggctgaataccacaaacagattgaaagcaacctgcaacgtattgagcgcaagaatcagcgcacatggtacagcaagcctggcgaacgcggcataacatgcagtggacgccagaaaattaagggaaaatcgattcctcttatctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z