BBa_K382028 1 BBa_K382028 Arabidopsis optimized Brazzein with StrepII C-terminus 2010-10-25T11:00:00Z 2015-06-11T01:10:47Z BBa_K382020 with biobricked strepII tag obtained from the Silver Laboratory. Arabidopsis optimized Brazzein (BBa_K382020) with a StrepII tag for western blot analysis. false false _488_ 4206 7814 9 It's complicated false N/A false Patrick Boyle annotation2114279 1 start codon range2114279 1 1 3 annotation2114280 1 Arabidopsis optimized Brazzein range2114280 1 1 165 annotation2114282 1 strepII-tag range2114282 1 172 201 annotation2114281 1 biobrick scar (standard 23) range2114281 1 166 171 BBa_K382028_sequence 1 atgcaagataagtgtaaaaaagtgtatgagaactatcctgtgagtaaatgccaattggcaaaccagtgcaattatgattgtaaactcgataagcacgctaggagtggagagtgtttctatgatgagaagaggaacctccagtgtatctgtgattattgtgagtatactagaagtgcttggtctcacccacaattcgaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z