BBa_K386004 1 BBa_K386004 pgaA promoter 2010-10-24T11:00:00Z 2015-05-08T01:12:18Z The sequence came from the E.coli genome data base. This part contains the pgaA promoter. pgaA is part of the pgaABCD operon which is a downstream target of the stress receptor BarA. false false _500_ 0 7173 9 Not in stock false This part contains the iGEM prefix and suffix. false Matthew Ford BBa_K386004_sequence 1 cggaatttatctgatttaattattttaatcctaatttattttgaaaaaggcattgggatttatgccgtattcctgaagatcctcatcattggaatggattttcgggcgagaaaaggattttatatggacactctgctcatcatttcttcttctcatcatcaacaattcacgtctctcttccgcgtttaataacggattatgaggtgcaaaaatatctttcttttcagttacctgtaattagatacagagagagattttggcaatacatggagtaatacagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z