BBa_K390004 1 BBa_K390004 art+ secretion tag for Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z This part is based on a sequence that was artificially designed in Sergeyenko and Los, 2003. It was created by annealing two oligionucleotides together. In ''Synechocystis'' sp. PCC 6803, the system of secretion is based on the charge of the N-terminus leader sequence. Positive charges on the N-terminus leader sequence contribute to secretion in a non-sequence-dependent manner (Sergeyenko TV and Los DA. 2003. Cyanobacterial leader peptides for protein secretion. FEMS Microbiology Letters 218: 351-357). This part is an artificially designed secretion tag from the above paper. It is composed of positively charged amino acids, and was shown to successfully function as a secretion tag in ''Synechocystis'' in the above paper. false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076215 1 Start Codon range2076215 1 1 3 annotation2076216 1 secretion tag - Synechocystis sp. PCC 6803 range2076216 1 1 64 BBa_K390004_sequence 1 atggatagaaagcacgtgctccggaaaaaagaagactctgcgcggaaaaaacaaaaaggtggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z