BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K390007 1 BBa_K390007 sigE Type II promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was Genomic sequence, but part was constructed by annealing two oligionucleotides together. This is the promoter of the ''sig''E sigma factor gene in ''Synechocystis'' sp. PCC 6803. This sigma factor has been observed to respond to circadian rhythm in PCC 6803, with increased expression during light exposure, and decreased expression in the dark. It also possesses a binding site for NctA, a nitrogen stress responsive regulatory protein, suggesting that it may also be nitrogen responsive. (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87) false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076282 1 NctA enhancer binding site range2076282 1 1 14 annotation2076283 1 -10 box range2076283 1 36 41 annotation2076281 1 sigE promoter range2076281 1 1 46 BBa_K390001 1 BBa_K390001 5'UTR and native RBS from psbA2 in Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Genomic sequences from Synechocystis sp. PCC 6803 This is the 5'UTR and RBS region from gene psbA2 in Synechocystis sp. PCC 6803. It covers the entire region from the end of the promoter (as reported in Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3: 65-87) to immediately before the start codon of the psbA2 gene. This part can serve as a general RBS for Synechocystis sp. PCC 6803, until a library of RBS strengths in PCC 6803 is assembled. The psbA2 gene codes for the photosystem II D1 protein in this species, and therefore we assume (and plan to verify) that the RBS strength is moderate to strong, due to the high requirement for this protein in photosynthesis. false false _518_ 0 6788 9 It's complicated false We decided to go with the full region from the promoter to the start codon. This means that, with the addition of the biobrick scar, the RBS may be located farther from the start codon then is optimal. We plan to determine optimum spacing of the RBS in Synechocystis sp. PCC 6803 in future work. false Cody Tramp annotation2076273 1 SDS core consensus range2076273 1 35 38 annotation2076274 1 native RBS range2076274 1 33 42 annotation2076272 1 5' UTR with native RBS range2076272 1 1 49 BBa_K208000 1 BBa_K208000 GFP 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z plasmid GFP false false _310_ 0 2425 303 It's complicated true Mutate PstI sites false Elisabeth Linton annotation2062217 1 GFP Coding Region range2062217 1 1 720 annotation2062216 1 Start range2062216 1 1 3 BBa_K390032 1 BBa_K390032 sigE promoter, 5' UTR and native RBS, and GFP 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z (coming soon) (coming soon) false false _518_ 0 6788 9 Not in stock false (coming soon) false Cody Tramp component2111055 1 BBa_K390007 component2111059 1 BBa_K390001 component2111067 1 BBa_K208014 annotation2111067 1 BBa_K208014 range2111067 1 110 966 annotation2111055 1 BBa_K390007 range2111055 1 1 46 annotation2111059 1 BBa_K390001 range2111059 1 55 103 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K208014 1 BBa_K208014 GFP (Silver Fusion)/Double Terminator 2009-10-19T11:00:00Z 2015-05-08T01:11:24Z Composite of GFP with BioBrick Terminator GFP with Terminator false true _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 component2056811 1 BBa_B0010 component2056813 1 BBa_B0012 component2056810 1 BBa_K208000 annotation2056810 1 BBa_K208000 range2056810 1 1 720 annotation2056811 1 BBa_B0010 range2056811 1 729 808 annotation2056813 1 BBa_B0012 range2056813 1 817 857 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K390007_sequence 1 gtatcacgaattacactgccgtgaaaatttaacgatattttggaca BBa_K390001_sequence 1 agtcagttccaatctgaacatcgacaaatacataaggaattataaccaa BBa_K208014_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K208000_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_K390032_sequence 1 gtatcacgaattacactgccgtgaaaatttaacgatattttggacatactagagagtcagttccaatctgaacatcgacaaatacataaggaattataaccaatactagatggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z