BBa_J13002 1 BBa_J13002 TetR repressed POPS/RIPS generator 2005-06-15T11:00:00Z 2015-08-31T04:08:29Z Released HQ 2013 -- No description -- false true _37_5_ 0 88 37 In stock false true Jeff Tabor component1535778 1 BBa_R0040 component1535786 1 BBa_B0034 annotation1535786 1 BBa_B0034 range1535786 1 63 74 annotation1535778 1 BBa_R0040 range1535778 1 1 54 BBa_K398108 1 bbc1 Salt tolerance cluster 2010-10-16T11:00:00Z 2015-05-08T01:12:22Z Genbank A protein from Chlamydomonas sp. W80 that increases the salt tolerance of E.coli. This protein is called bbc1. The exact mechanism of the increased salt tolerance is as of yet unknown. But since bbc1 shows a high homology to RBS binding proteins, it is theorized that it may prevent/stabilize the folding structure of the ribosome under high salt stress conditions. false false _506_ 0 6352 9 It's complicated true Nucleotide sequence optimized for expression in E.coli false Ramon van der Valk component2093219 1 BBa_K398100 component2093226 1 BBa_B0015 component2093215 1 BBa_J13002 annotation2093219 1 BBa_K398100 range2093219 1 81 707 annotation2093215 1 BBa_J13002 range2093215 1 1 74 annotation2093226 1 BBa_B0015 range2093226 1 716 844 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K398100 1 BBa_K398100 bbc1 2010-06-12T11:00:00Z 2015-05-08T01:12:22Z Genbank Protein from Chlamydomonas sp. W-80 that enhances salt-stress tolerance in E.coli. Nucleotide sequence optimized for expression in E.coli. false false _506_ 0 6320 9 It's complicated false None false Mathias Voges annotation2070760 1 bbc1 range2070760 1 1 627 annotation2070759 1 stop range2070759 1 625 627 annotation2070758 1 start range2070758 1 1 3 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J13002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaa BBa_K398108_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggttcgtggtaacgacatgctgccgaacggtcacttccacaaaaaatggcagttccacgttaaaacctggttcaaccagccagctcgtaaacagcgtcgtcgtaacgctcgtgctgaaaaagctaaagctaccttcccgcgtccggttgctggttctctgaaaccgatcgttcgttgccagaccgttaaatacaacaccaaacagcgtctgggcaggggcttcaccctggaagagctgaaagaagctggtatcccggctaagttcgctccgaccgttggtatcgctgttgaccaccgtcgtaaaaaccgttctctggaaaccctgcaagctaacgttcagcgtctgaaaacctaccgtgcttctctggttatcttcccgcgtaacatgaaaaaaccgaaagctttcgaagcttctgctgctgactgctctgctgcttctcaggctaaaggtgaactgctgccgctgaaaggtaccaaaccggctctggaactggttaaaatcaccgctgacatgaaagaaggttctcagtacggtaaactgcgtatcgaacgtgttaacgctcgtctgaaaggtatgcgtgaaaaacgtgctgctgacgaagctgctaaaaaagacgacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K398100_sequence 1 atggttcgtggtaacgacatgctgccgaacggtcacttccacaaaaaatggcagttccacgttaaaacctggttcaaccagccagctcgtaaacagcgtcgtcgtaacgctcgtgctgaaaaagctaaagctaccttcccgcgtccggttgctggttctctgaaaccgatcgttcgttgccagaccgttaaatacaacaccaaacagcgtctgggcaggggcttcaccctggaagagctgaaagaagctggtatcccggctaagttcgctccgaccgttggtatcgctgttgaccaccgtcgtaaaaaccgttctctggaaaccctgcaagctaacgttcagcgtctgaaaacctaccgtgcttctctggttatcttcccgcgtaacatgaaaaaaccgaaagctttcgaagcttctgctgctgactgctctgctgcttctcaggctaaaggtgaactgctgccgctgaaaggtaccaaaccggctctggaactggttaaaatcaccgctgacatgaaagaaggttctcagtacggtaaactgcgtatcgaacgtgttaacgctcgtctgaaaggtatgcgtgaaaaacgtgctgctgacgaagctgctaaaaaagacgacaaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z