BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1761 1 luxI range1761 1 1 579 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 BBa_K415033 1 BBa_K415033 Fixed-pLux/cI-OR : RBS : LuxI 2010-10-25T11:00:00Z 2015-05-08T01:12:26Z 2010 MIT iGEM Team, BBa_R0065 LuxI expression controlled by a hybrid promoter that is activated by a LuxR-AHL complex and inhibited by cI. The "fixed" promoter is [[Part:BBa_K415031]] which is a more tightly controlled (less noisy) version of [[BBa_R0065]]. false false _525_ 0 6736 9 Not in stock false None; false Leanna Morinishi component2103948 1 BBa_C0261 component2103941 1 BBa_K415031 annotation2103948 1 BBa_C0261 range2103948 1 77 737 annotation2103941 1 BBa_K415031 range2103941 1 1 68 BBa_C0261 1 BBa_C0261 AHL-making Enzyme, luxI (+RBS) 2004-08-22T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 B0034.C0061 false false _6_ 0 159 7 In stock true true robertb component1060403 1 BBa_B0034 component1060413 1 BBa_C0061 annotation1060403 1 BBa_B0034 range1060403 1 1 12 annotation1060413 1 BBa_C0061 range1060413 1 19 636 BBa_K415031 1 pLux/cI-OR Improved PLux/cI-OR Promoter 2010-10-21T11:00:00Z 2015-05-08T01:12:26Z This is a hybrid promoter synthesized from a portion of the Vibrio Fischerii Lux operon and the cI/cro switch of Lambda bacteriophage. This part is a promoter that was designed as a correction to the anomalous BBa_R0065 BioBrick. This part consists of a Lux Box binding site for the LuxR-C6HSL Complex; in addition, it contains two operator sites for the cI protein appropriated from the Lambda bacteriophage. Because basal expression without the LuxR-C6HSL complex present is expected to be minimal, and because the cI operator sites are positioned so as to block the critical -10 transcription initiation site on the promoter, if cI is high, the promoter is off; if AHL is low and cI is absent, the promoter is leaky; if AHL is high and cI is absent, the promoter is on. false false _525_ 0 6719 9 It's complicated false This promoter was designed entirely as a result of issues with the R0065 promoter, which was essentially designed as a literal fusion of two promoters that happened to contain twin -10 transcription initiation sites. This resulted in a promoter that was not leaky without the presence of AHL, but constitutively on. This newly designed promoter should properly follow the logic detailed above. false Grant Robinson BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K415031_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggttata BBa_K415033_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggttatatactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0261_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z