BBa_K416000 1 BBa_K416000 Aga2 CDS Responsible for Yeast Surface Display 2010-05-27T11:00:00Z 2015-05-08T01:12:27Z This parts was biobricked from the pCTCON2 plasmid which was sent to us by Dr. D. K. Wittrup at MIT. The Aga2 protein is fused in frame with a protein that the user wants to display on the yeast cellular surface. Yeast cells constitutively expressing Aga1 (strain EBY100) secrete the Aga2 fusion protein, which associates with Aga1 through two disulfide bonds and quaternary structure to anchor Aga2 to the surface. The fused protein then is displayed on the surface of the yeast cell. The STOP codon at the end of the CDS was removed to allow for N- and C-terminus fusions. false false _527_ 0 6443 9 Not in stock true We removed the STOP codon to allow for N- and C-terminal fusions, which have both been proven to occur efficiently. false Russell Durrett annotation2069499 1 Aga2 CDS range2069499 1 1 261 BBa_K416000_sequence 1 atgcagttacttcgctgtttttcaatattttctgttattgcttcagttttagcacaggaactgacaactatatgcgagcaaatcccctcaccaactttagaatcgacgccgtactctttgtcaacgactactattttggccaacgggaaggcaatgcaaggagtttttgaatattacaaatcagtaacgtttgtcagtaattgcggttctcacccctcaacaactagcaaaggcagccccataaacacacagtatgttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z