BBa_K416002 1 BBa_K416002 36 Base Pair LoxP 2010-05-31T11:00:00Z 2015-05-08T01:12:27Z Amplified and biobricked from E. coli. The antibody for the c-myc transcription factor. This protein binds to Enhancer Box sequences and recruits histone acetyltransferases, serving as a traditional transcription factor and a regulator of global chromatin structure. false false _527_ 0 6462 9 It's complicated true The coding region of the gene was isolated via PCR. Biobrick prefix and suffix were added during amplification, and ligated into Ampicillin resistant plasmids. false Russell Durrett BBa_K416002_sequence 1 ataacttcgtataatgtatgctatacgaagttatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z