BBa_K424004 1 BBa_K424004 LuxC gene from V. fischeri for generating light. 2010-06-06T11:00:00Z 2015-05-08T01:12:28Z ACCESSION Y00509 REGION: 1624..1866 AUTHORS Engebrecht,J. and Silverman,M. TITLE Nucleotide sequence of the regulatory locus controlling expression of bacterial genes for bioluminescence JOURNAL Nucleic Acids Res. 15 (24), 10455-10467 (1987) PUBMED 3697093 Which species is the enzyme from? Vibrio fischeri What reaction does it catalyze? One of five steps in the production of light. Does it work in E. coli? Yes, several groups have used this operon as a reporter in E. coli. Does it require any other parts? Yes. The full luxCDABE operon is needed for light production. true false _545_ 0 6272 9 Discontinued false Requires the other four steps in the LuxABCDE process false Patrick Nee annotation2070321 1 TaaTaa range2070321 1 246 252 annotation2070323 1 LuxC protien range2070323 1 35 224 annotation2070322 1 Start range2070322 1 23 29 BBa_K424004_sequence 1 ataggttcgtcgccgattatattcttcacttttccatcgttgaccaacggtatataaaaaattcacaatctgatttaaatttagattaattctatctttgatatttaatgtttttgaaactgaactttcagtaatgacagataattttactctattatcattatttagtttaacttctttatatgcataattatcaaaatcttgaatcattccattaattatcattggaatacatttattcattaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z