BBa_K426005 1 BBa_K426005 Tn5 3'TR 2010-10-25T11:00:00Z 2015-05-08T01:12:28Z Synthetic This part encodes a DNA cis element. DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them. This part is associated with Tn5 transposon devices. Tn5 transposase is a popular enzyme that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome). Unlike Sleeping Beauty and piggyBac which comes from eukaryotic organisms, Tn5 comes from enterobacterial tranposons. false false _541_ 0 7241 9 It's complicated false NA false Daniela Mehech BBa_K426005_sequence 1 gatctggttgagatgtgtataagagacagtcgacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z