BBa_K509000 1 BBa_K509000 Cauliflower Mosaic Virus 35S promoter 2011-09-14T11:00:00Z 2015-05-08T01:12:30Z Was supplied to the UEA-JIC team by a researcher at the University of East Anglia who supplied it in a plasmid containing the promoter, a GUS gene and a NOS terminator. This part is a promoter from the Cauliflower Mosaic Virus (CaMV), called the 35S promoter. It is a strong constitutive promoter which is often used in plant research, however it also works in E. coli. It is similar to Biobrick BBa_K414002 however it has been shortened to the last 320 base pairs, as these are the active part of the promoter. false false _672_ 0 8541 9 Not in stock false Had to produce primers to allow PCR of the target sequence to reduce the size from 1000bp to 320bp. false Alistair Walsham BBa_K509000_sequence 1 cgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgacatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z