BBa_K518010 1 sulAp sulA promoter 2011-09-26T11:00:00Z 2015-05-08T01:12:33Z Cloned from E. coli K12 strain genome. Microbes including Escherichia coli are known to respond to various DNA-injuring stress (ionizing radiation, ultraviolet radiation, peroxides etc...), altering their gene expressions. This response, known as "SOS response", are induced by regulatory protein called RecA, which is activated when binds to single-strand DNA. DNA-RecA complex promotes the self-degradation of LexA, a common repressor for SOS genes. SulA is responsible for stress-induced halt of cell division. The promoter of sulA, or sulAp, is acutely induced by various stress factors. false false _683_ 0 8305 9 In stock true None. false Masato Ohgishi BBa_K518010_sequence 1 gggttgatctttgttgtcactggatgtactgtacatccatacagtaactcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z