BBa_K531001 1 BBa_K531001 <i>C. crescentus</i> S-layer RsaA C-term 2011-07-03T11:00:00Z 2015-05-08T01:12:36Z This comes from genomic ''Caulobacter'' CB15N. This is a secretion tag for secretion via a Type I secretion pathway in ''Caulobacter crescentus''. It should be appended to the C-terminal end of another protein to act as a secretion tag. false false _697_ 0 8840 9 In stock true Using the Registry's suggested primer combinations results in the formation of an in sequence stop codon between two coding regions. A one nucleotide change was necessary in both the prefix of this coding sequence and the suffix of the coding region to be added in front of this gene to ensure that their is no stop codon in sequence. false Alexander Aaring BBa_K531001_sequence 1 gatatcaacgctatcggcacctcgaccgctttcgtgacgatcaccgacgccgctgtcggcgacaagctcgacctcgtcggcatctcgacgaacggcgctatcgctgacggcgccttcggcgctgcggtcaccctgggcgctgctgcgaccctggctcagtacctggacgctgctgctgccggcgacggcagcggcacctcggttgccaagtggttccagttcggcggcgacacctatgtcgtcgttgacagctcggctggcgcgaccttcgtcagcggcgctgacgcggtgatcaagctgaccggtctggtcacgctgaccacctcggccttcgccaccgaagtcctgacgctcgcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z