BBa_K548000 1 Aeq Humanized Aequorin 2011-09-26T11:00:00Z 2015-05-08T01:12:39Z Synthesized from GeneArt, original sequence from NCBI, optimized using GeneArt codon optimization software. Released HQ 2013 This is a human cell line optimized version of Aequorin, a bioluminescent protein found in various jellyfish and other marine organisms. The protein requires Ca2+ for catalytic activity. And oxidizes its substrate, Coelenterazine to emit blue light (λmax=469nm). Aequorin is NOT a fluorescent protein, it does not require an excitation light source to emit light. Transfection of the gene into 293T cells using lipofectamine has been confirmed. The part contains EcoRI and PstI restrictions sites, and is ligated to the iGEM pSB1C3 backbone. This backbone provides chloramphenicol resistance. false false _716_ 0 8882 9 In stock false Original sequence had to be modified for increased expression in human cell lines. false Peter Qiao BBa_K548000_sequence 1 atgaccagcaagcagtacagcgtgaagctgaccagcgacttcgacaacccccggtggatcggccggcacaagcacatgttcaactttctggacgtgaaccacaacggcaagatcagcctggacgagatggtgtacaaggccagcgacatcgtgatcaacaacctgggcgccacccccgagcaggccaagagacacaaagatgccgtggaagccttcttcggcggagccggcatgaagtacggcgtggaaacagactggcccgcctacatcgagggctggaagaagctggccaccgacgagctggagaagtacgccaagaacgagcccaccctgatcagaatctggggcgacgccctgttcgatatcgtggacaaggaccagaacggcgccatcaccctggatgagtggaaggcctacaccaaggccgctggcatcatccagagcagcgaggactgcgaagagacattcagagtgtgcgacatcgacgagagcggccagctggatgtggatgagatgacccggcagcacctgggcttttggtacaccatggaccccgcctgcgagaagctgtatggcggagctgtgccttagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z