BBa_K553021 1 BBa_K553021 Mammalian Tra-R inducible element 2011-09-16T11:00:00Z 2015-05-08T01:12:40Z a This part constitutes the core of the TraR binding site (Tra-Box). When combined to have different repeats (1 to 7) and associated to a minimal CMV promoter (CMVmin, BBa_553022), it can be used as a mammalian TraR-inducible gene expression system. false false _721_ 0 8729 9 It's complicated true It has been tested cloned seven times before a CMVmin promoter. false Luca Braga, Niels Ntamati BBa_K553021_sequence 1 ggtcggctgaaagggaatgtgcagatctgcacatcggcaacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z