BBa_K562002 1 Salty_D40 Salty_PduD40 Targeting Tag 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence. This is a composite part comprising a constituive promoter (identical to that from the basic part BBa_K562000), which is the tatABCD promoter from E. coli K-12, driving production of the first 40 amino acid residues of the PduD protein from Salmonella enterica serovar Typhimurium LT2. This is a targeting sequence for the Salmonella Pdu bacterial microcompartment (BMC). This 40 residue targeting sequence has been tested by fusion to GFP and it does work. The construct is coloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-D40 in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 It's complicated false The fragment carries an XbaI site at the extreme 3' end. Thus, to clone your gene of interest in-frame with this targeting sequence all you need do is place the 6-nucleotide XbaI site immediately upstream of your ATG initiation codon false Frank Sargent annotation2129407 1 synthetic RBS range2129407 1 107 112 annotation2129406 1 BBa_K562000 range2129406 1 1 103 annotation2129408 1 PduD40 Tag range2129408 1 119 238 BBa_K562002_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatggaaattaatgaaaaattgctgcgccagataattgaagacgtactccgcgatatgaagggcagcgataaacccgtctcgtttaatgcgcctgcggcatccacagcaccacagaccgcttctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z