BBa_K562005 1 Salty_PduN Salty_PduN BMC Component 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence. This is a composite part comprising a constituive promoter (identical to that from the basic part BBa_K562000), which is the tatABCD promoter from E. coli K-12, driving production of the PduN protein from Salmonella enterica serovar Typhimurium LT2. This is a component of the Salmonella bacterial microcompartment (BMC). The PduN gene product carries a C-terminal 6-His affinity/epitope tag. Production of the PduN protein has been verified by Western immunoblotting (anti-penta-His) and production of PduN has been confirmed by 35S-Met labelling. The protein has also been purified from E. coli by immobilised metal affinity chromatography (IMAC) and identified by tryptic peptide mass fingerprinting. The construct is cloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-N in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 It's complicated false The fragment carries an engineered BamHI site at its extreme 3' end. false Frank Sargent annotation2129425 1 BBa_K562000 range2129425 1 1 103 annotation2129427 1 pduN gene range2129427 1 119 391 annotation2129426 1 synthetic RBS range2129426 1 107 112 annotation2129428 1 Hexa-Histidine Tag range2129428 1 392 409 BBa_K562005_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatgcatctggcacgagtcacgggcgcggttgtctccacgcaaaaatcaccttctttgattgggaaaaagctgctgctggtgcgtcgggtcagcgccgatggcgaactccccgcctcgcccacctccggcgatgaagtggccgtggactccgtcggcgcgggcgtcggcgaactggttttgctcagcggcggctccagcgccaggcacgttttttccgggccaaatgaggccattgacctcgccgttgtcggcattgtagatacgctttcgtgtcatcaccatcaccatcactaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z