BBa_K566001 1 pRM pRM promoter from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. pRM promoter from Lambda phage. It may be positive and negative regulated according to cI protein concentration. It needs OL region in order to achieve better negative regulation. It may be used to establish a biphasic switch which could permit activation and repression of genes transcribed from it. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2145891 1 pRM range2145891 1 1 85 BBa_K566001_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z