BBa_K571004 1 BBa_K571004 R0011+RBS/pSB1C3 2011-10-02T11:00:00Z 2015-05-08T01:12:44Z BBa_R0011 This biobrick contains the BBa_R0011 promoter of 80 bp cloned in pSB1C3 with EcoRI and XbaI restriction site which will can be induced by IPTG. RBS is added to the end of the sequence in order to enable gene expression to perform well. false false _739_ 0 10422 9 It's complicated false none. false Lu-Chu Ke annotation2151465 1 RBS range2151465 1 64 80 annotation2151464 1 R0011 range2151464 1 1 55 BBa_K571004_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagttaaggaggtaaaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z