BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K592024 1 BBa_K592024 B0034-BFP 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z The BFP part is <partinfo>BBa_K592100</partinfo> Released HQ 2013 Blue Fluorescent Protein (<partinfo>BBa_K592100</partinfo>) with B0034 RBS. One can add any promoter upstream of this gene. false true _763_ 0 7929 9 In stock false The BFP part (<partinfo>BBa_K592100</partinfo>) was codon-optimized for expression in E.coli by DNA2.0 false Lei Sun component2136696 1 BBa_K592100 component2136694 1 BBa_B0034 annotation2136694 1 BBa_B0034 range2136694 1 1 12 annotation2136696 1 BBa_K592100 range2136696 1 19 723 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K592024_sequence 1 aaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z