BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z