BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K593003 1 BBa_K593003 Lush protein 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z a a false false _764_ 0 6077 9 Not in stock false a false Ceren Seref BBa_K593002 1 BBa_K593002 LUSH protein coding device 2011-09-18T11:00:00Z 2015-05-08T01:12:49Z This gene is extracted from the genomic sequence of Drosophila melanogaster LUSH is an alcohol-sensitive odorant binding protein expressed in eukaryotic organism in the olfactory organs of Drosophila melanogaster, and it is used as a model system to investigate the biophysical nature of alcohol-protein interactions at alcohol concentrations false false _764_ 0 6079 9 It's complicated true This sequence is adjusted according to E.coli for any incompatibility false Sibel Ataol component2136819 1 BBa_J23101 component2136823 1 BBa_K593003 component2136821 1 BBa_B0030 component2136828 1 BBa_B1002 annotation2136823 1 BBa_K593003 range2136823 1 65 436 annotation2136819 1 BBa_J23101 range2136819 1 1 35 annotation2136821 1 BBa_B0030 range2136821 1 44 58 annotation2136828 1 BBa_B1002 range2136828 1 445 478 BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_K593003_sequence 1 atgaccatggaacagttcctgacctctctggacatgatccgttctggttgcgctccgaaattcaaactgaaaaccgaagacctggaccgtctgcgtgttggtgacttcaacttcccgccgtctcaggacctgatgtgctacaccaaatgcgtttctctgatggctggtaccgttaacaaaaaaggtgagttcaacgctccgaaagctctggctcagctgccgcacctggttccgccggaaatgatggaaatgtctcgtaaatctgttgaagcttgccgtgacacccacaaacagttcaaagaatcttgcgaacgtgtttaccagaccgctaaatgcttctctgaaaacgctgacggtcagttcatgtggccg BBa_B0030_sequence 1 attaaagaggagaaa BBa_K593002_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagattaaagaggagaaatactagatgaccatggaacagttcctgacctctctggacatgatccgttctggttgcgctccgaaattcaaactgaaaaccgaagacctggaccgtctgcgtgttggtgacttcaacttcccgccgtctcaggacctgatgtgctacaccaaatgcgtttctctgatggctggtaccgttaacaaaaaaggtgagttcaacgctccgaaagctctggctcagctgccgcacctggttccgccggaaatgatggaaatgtctcgtaaatctgttgaagcttgccgtgacacccacaaacagttcaaagaatcttgcgaacgtgtttaccagaccgctaaatgcttctctgaaaacgctgacggtcagttcatgtggccgtactagagcgcaaaaaaccccgcttcggcggggttttttcgc BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z