BBa_K606034 1 Y taRNA Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis. false false _778_ 0 8998 9 In stock false This sequence is the pure tRNA without the side sequences false Cyrille Pauthenier BBa_K606034_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z