BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K607015 1 BBa_K607015 cI 2011-09-17T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution cI without degradation tag false true _779_ 0 9177 9 Not in stock false none false Olesja Popow BBa_K607018 1 BBa_K607018 Prm_cI-DAS_antiPlasB with 1.0RBS 2011-09-17T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution cI with moderately fast tag under transcriptional control of Prm promoter and reverse antisense lasB promoter, the RBS has a strength of 1.0 (obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter). This construct represents an auto-inducing loop in which the Prm promoter drives expression of its own inducer cI. The running loop can be turned off by activating the reverse antisense lasB promoter (through LasR protein in the presence of Pseudomonas autoinducer (PAI)) false false _779_ 0 9177 9 It's complicated true We decided to keep PAI concentrations in the media constant (by adding N-(3-oxododecanoyl)homoserine lactone) and control the expression of LasR protein in order to achieve tight control of the reverse antisense lasB promoter. false Olesja Popow component2132579 1 BBa_B0034 component2132582 1 BBa_M0052 component2132584 1 BBa_K607008 component2132571 1 BBa_B0025 component2132591 1 BBa_B0015 component2132577 1 BBa_I12006 component2132580 1 BBa_K607015 annotation2132580 1 BBa_K607015 range2132580 1 246 956 annotation2132579 1 BBa_B0034 range2132579 1 228 239 annotation2132584 1 BBa_K607008 range2132584 1 1006 1106 annotation2132582 1 BBa_M0052 range2132582 1 965 997 annotation2132571 1 BBa_B0025 range2132571 1 1 129 annotation2132591 1 BBa_B0015 range2132591 1 1115 1243 annotation2132577 1 BBa_I12006 range2132577 1 138 219 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_M0052 1 BBa_M0052 AANDENYADAS (moderately fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z This variation of the SsrA tag was studied by McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. SsrA tags are prevalent in E. coli. This sequence codes for the amino acid sequence AANDENYADAS, a slower variation of the WT SsrA tag sequence, which, when fused to the C-terminal of proteins, will make the protein susceptible to moderately fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~1 Vmax/ [Clpx6] min-1 from (1). See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is moderately fast. Variations of this sequence yield different degradation rates(see Parts BBa_M0050, BBa_M0051, BBa_M0053). Sequence derived from reverse translation of AANDENYADAS sequence using codon usage optimized for E. coli. Three C-terminal aa's (DAS in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. See sources on the main part page for further information about the mechanism of the system. NOTE: this sequence has only the amino acid sequence for the tag and bears NO STOP CODONS, so be sure to include them if you use this sequence. false Felix Moser annotation1958882 1 AANDENYADAS SsrA degradation tag range1958882 1 1 33 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K607008 1 BBa_K607008 reverse lasB promoter 2011-09-15T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution antisense reverse lasB promoter false false _779_ 0 9177 9 Not in stock false none false Olesja Popow annotation2132497 1 misc range2132497 1 1 101 BBa_I12006 1 Prm + Modified lamdba Prm promoter (repressed by 434 cI) 2004-07-13T11:00:00Z 2015-08-31T04:07:31Z Bushman(1993), Shih & Gussin (1983) Released HQ 2013 Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) false false _3_ 0 147 7 In stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. true mcnamara annotation786500 1 OR1 lambda range786500 1 9 25 annotation786518 1 OR2 lambda range786518 1 33 49 annotation837284 1 -35 range837284 1 48 53 annotation786365 1 OR1 434 range786365 1 56 69 annotation837228 1 -10 range837228 1 71 76 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K607015_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggc BBa_K607008_sequence 1 gctttcgtgtaccaaaaagaacccgcggccaaacctgccagaactggcaggtagccttgatttcgccggaaatctgtatgttttcgctggaatagctagca BBa_M0052_sequence 1 gctgctaacgacgaaaactacgctgacgcttct BBa_B0034_sequence 1 aaagaggagaaa BBa_K607018_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagaggcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgttactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctactagaggctgctaacgacgaaaactacgctgacgcttcttactagaggctttcgtgtaccaaaaagaacccgcggccaaacctgccagaactggcaggtagccttgatttcgccggaaatctgtatgttttcgctggaatagctagcatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I12006_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z