BBa_K611097 1 BBa_K611097 LVA Tag, Double Stop Codon, Truncated Barcode (3' -8bp) 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This is a truncated version of the LVA Degradation Tag-TAATAA Double Stop Codon-Barcode region. The last 8 3' bases have been truncated from the Barcode in order to pinpoint where promoter activity is originating from in the LVA-TAATAA-Barcode region. This is part of 8 truncation combinations of this region. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175856 1 Barcode (3' -8bp) range2175856 1 40 56 annotation2175855 1 LVA range2175855 1 1 33 BBa_K611097_sequence 1 gctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z