BBa_K611103 1 BBa_K611103 LVA tag, Double Stop Codon, Barcode 2012-05-17T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This part is comprised of an LVA degradation tag, a TAATAA double stop codon, and a barcode (the same barcode as in BBa_C0051) with a G nucleotide in the X position of the CXC on either side of the barcode. This part is used for determining promoter activity in this region. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2176033 1 Barcode range2176033 1 40 64 annotation2176034 1 LVA range2176034 1 1 33 BBa_K611103_sequence 1 gctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z