BBa_K624035 1 BBa_K624035 revised minC primer (reverse) 2011-10-04T11:00:00Z 2015-05-08T01:12:55Z no. As mentioned in the description of [http://partsregistry.org/Part:BBa_K624033 BBa_K624034],this was the forward primer we used. false false _796_ 0 8576 9 Not in stock false no. false Yi-Hong Liou BBa_K624035_sequence 1 gttcctgcagcggccgctactagtattattaatttaacggttgaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z